EECS 1015: Midterm programming exam (Variables, expressions, strings, flow-control, functions) solution

$24.99

Original Work ?

Download Details:

  • Name: midterm-lmat2r.zip
  • Type: zip
  • Size: 967.60 KB

Category: You will Instantly receive a download link upon Payment||Click Original Work Button for Custom work

Description

5/5 - (5 votes)

TASK 0 (0 points correct, -10 points deducted if you forget or have the wrong information)
The function task0 should print out the following information:
Midterm Exam – EECS1015
Name: Your Name
Student ID: Your York ID
email: youremail@aol.com
TASK 1 (15 points)
[Testing: Variables and expression, strings, input, and outputting formatted text]
Function task1 should do the following:
(1) Prompt the user to input their first name.
(2) Prompt the user to input their last name.
(3) Prompt the user to ask them how many hours they work a week.
(4) Prompt the user to ask them what is their hourly wage.
(5) Based on the information obtained from (1)-(4), print out the following:
Employee: LASTNAME, Firstname
$XXXX.XX Monthly salary (gross)
-$YYYY.YY 25% Tax deduction
$ZZZZZ.ZZ Monthly salary (net)
Example:
Your first name: ABDEL
Your last name: Zhang
Hours you work per week: 30
Hourly wage: 18.88
Employee: ZHANG, Abdel
$2265.60 Monthly salary (gross)
$-566.40 25% Tax deduction
$1699.20 Monthly salary (net)
See accompanying video: https://www.eecs.yorku.ca/~mbrown/EECS1015midterm.mp4
You should trip off all white-spaces.
Last name should be printed with All capitals letters.
First name should be printed with first letter capital, the rest lower case.
Monthly salary (gross) is hours per week * hourly wage * 4
Tax deduction is monthly salary * 0.25
Monthly salary (net) is your (gross) salary minus the taxes. This is the amount
you have after taxes.
All amounts should be printed with 2 decimal places.
Red text is entered by user. Notice the extra spaces for items 1
and 2.
NOTE: You may assume the that other than white-space, the user’s
input will be correct. For example, you do not need to check
if the hours per week or hourly wage are numbers – you can
assume they will be provided correctly.
Page 3/10
TASK 2 (30 points)
[Testing: Variables and expression, strings, conditional-statements, loops]
Function task2 allows users to order items from a menu as shown below.
The user starts out with a total $10.00. Your function should begin by printing out the user’s balance (amount
of money they have left) and the 4 menu items below with the associated prices (you need to use the exact
items and prices below). The user can then input the item they’d like to order. They can enter 0 to exit.
You have $10.00 – what item do you want?
1: Falafel $3.00
2: Pizza $6.00
3: Salad $1.50
4: Coffee $1.00
Enter 0 to exit.
Your order: 1
Order for *falafel* confirmed.
You have $7.00 – what item do you want?
1: Falafel $3.00
2: Pizza $6.00
3: Salad $1.50
4: Coffee $1.00
Enter 0 to exit.
Your order: 2
Order for *pizza* confirmed.
(1) User enters a 0 or has no more money.
You have $1.00 – what item do you want?
1: Falafel $3.00
2: Pizza $6.00
3: Salad $1.50
4: Coffee $1.00
Enter 0 to exit.
Your order: 4
Order for *coffee* confirmed.
Thank you!
(1) WHAT TO DO IF THE USER DOES NOT HAVE ENOUGH MONEY? or (2) puts in a order that isn’t “1” to “4”?
You have $1.00 – what item do you want?
1: Falafel $3.00
2: Pizza $6.00
3: Salad $1.50
4: Coffee $1.00
Enter 0 to exit.
Your order: 1
Sorry, you don’t have enough money for that item.
See accompanying video: https://www.eecs.yorku.ca/~mbrown/EECS1015midterm.mp4
Depending on what input the user provides you should do the
following:
(1) Make sure they have enough money to purchase the item.
(2) If they do, print out “Order for *ITEM* confirmed.” (replace ITEM
with what they purchased).
(3) Deduct the item’s price from the total.
If the user enters 0 or has no more money,
finish the task by print “Thank you!”
(1) If the user does not have enough money for an
item, print the following “Sorry, you don’t have
enough money for that item”.
(2) If the user inputs an order that is not “1” to “4”,
just repeat and ask what they would like to purchase.
Page 4/10
TASK 3 (25 points)
[Testing: Variables and expression, strings, conditional-statements, loops]
Function task3 should perform as follows:
Simulate rolling a dice 10 times. Each roll generates a random number between 1-6 and print it as shown
below. If a [6] is rolled, print it out with ** around it (see below). If two or more of the rolls are a “6”s, print
“YOU WIN”, otherwise print “YOU LOSE”.
Keep repeating the game until the user types in a “N”. See below:
Rolling dice 10 times . . .
[3]
[1]
[1]
[4]
[3]
[1]
[5]
[2]
[2]
[3]
YOU LOSE!
Do you want to play again? (Y/N):
Rolling dice 10 times . . .
[2]
[2]
*[6]*
[1]
*[6]*
[5]
*[6]*
[1]
[5]
[3]
YOU WIN!
Do you want to play again? (Y/N): N
See accompanying video: https://www.eecs.yorku.ca/~mbrown/EECS1015midterm.mp4
Page 5/10
Task 4 (30 points)
[Testing: Variables and expression, strings, conditional-statements, loops, functions]
Function task4 will require you to also define three additional functions as follows:
1. generateDNASequence() -> returns a string a string of 40 characters
2. applyGammaRadiation(param: string) -> returns a string of 40 characters
3. detectMutation(param: string1, string2) -> returns a string of 40 characters
See figure below that explains the relationship of the three functions.
Further details are provided after the figure.
Task 4 should be implemented as follows:
(1) Task4 should first call the function generateDNASequence(). The function generateDNASequence()
will return a string of 40 characters. The string should be randomly generated character by character. Each
character can be only one of the following characters: “T”, “G”, “C”, or “A”. These characters are the letters
used to describe a DNA sequence. The function should return the randomly generated string.
See an example string: TCTTGCTGTTACAGGATATGATGCTGCTGCGACGCCAGCC
Task 4’s description continues on the next page . . .
Page 6/10
(2) Task4 should now call the function applyGammaRadiation(param: string)
The function applyGammaRadiation() should be passed the string created by the function
generateDNASequence() as an argument as shown in the figure. The function
applyGammaRadiation() has a 50% chance to mutate one of the letters in the DNA sequence.
[Compute 50% chance?] To perform the 50% chance mutation, compute a random number between 1 and
100. If the number is greater than 50, mutate the DNA sequence. Otherwise, don’t mutate it.
[How to mutate the sequence?] Randomly select one of the letters in the DNA string (recall the string is size
40 characters). For the letter at your selected position, you should then randomly change its value to one of
the other allowed DNA values. For example, say you selected position 30 to mutate and it has the letter “A”.
Then you need to randomly select “T”, “G”, or “C”. If at position 30 it instead had the letter “C”, then you
would need to randomly change it to “A”, “G”, or “T”.
[What to return?] If you mutated the string, then you should return a new string where one of the DNA letters
has been changed.
Here is an example:
TCTTGCTGTTACAGGATATGATGCTGCTGCGACGCCAGCC (parameter passed to function)
TCTTGCTGTTACAGGATATGATGCTGCAGCGACGCCAGCC (return string with a mutation)
If no mutation occurred, then return the same string passed. For example:
TCTTGCTGTTACAGGATATGATGCTGCTGCGACGCCAGCC (parameter passed to function)
TCTTGCTGTTACAGGATATGATGCTGCTGCGACGCCAGCC (return string with no mutation)
(3) Task4 should now call the function detectMutation(string1, string2)
The function detectMutation(string1, string2) is passed the original DNA string and the DNA string
after gamma radiation has been applied. Detecting a mutation must be done by comparing each characters in
the two DNA string sequences to see if they are the same or different. The function detectMutation
should return a new string that is 40 characters long. If there is no mutation, this string will be all spaces,
however, if there is a mutation then place a “^” in the string at that location the mutation occurred.
Here is an example (with a mutation):
Parameters: “TCTTGCTGTTACAGGATATGATGCTGCTGCGACGCCAGCC”
“TCTTGCTGTTACAGGATATGATGCTGCAGCGACGCCAGCC”
Returns: ” ^ ”
Here is an example (without mutation):
Parameters: “TCTTGCTGTTACAGGATATGATGCTGCTGCGACGCCAGCC”
“TCTTGCTGTTACAGGATATGATGCTGCTGCGACGCCAGCC”
Returns: ” ”
Task 4’s description continues on the next page . . .
Page 7/10
Now that you have seen the functions, task4 should print out as follows:
TCTTGCTGTTACAGGATATGATGCTGCTGCGACGCCAGCC (DNA)
TCTTGCTGTTACAGGATATGATGCTGCAGCGACGCCAGCC (DNA after radiation)
^
MUTATION DETECTED
Or, when no mutation is present, print out:
CTCTGAAAATCCTCCGTTTGTACGCGTGTCTATACATGTT (DNA)
CTCTGAAAATCCTCCGTTTGTACGCGTGTCTATACATGTT (DNA after radiation)
NO MUTATION DETECTED
See accompanying video: https://www.eecs.yorku.ca/~mbrown/EECS1015midterm.mp4
FINAL COMMENTS: For tasks 1-4 you may introduce additional functions, however, it is not
required and will not affect your grade either way. For Task4, you must define the three
functions as required in the task’s description. All 5 tasks (Task0 – 4) must be written in a
single file named “midterm.py”. All tasks should run one after the other as shown in
the accompanying video.
See pages below on how to submit your midterm code.
MAKE SURE TO SELECT midterm with websubmit.
Result from generateDNASequence
Result from applyGammaRadiation
Result from detectMutation
If there is a mutation detected, print
“MUTATION DETECTED”
Result from generateDNASequence
Result from applyGammaRadiation
Result from detectMutation
(all spaces – so it looks empty)
If there is no mutation detected,
print “NO MUTATION DETECTED”
Page 8/10
3. SUBMISSIONS (EECS web-submit)
You will submit your lab using the EECS web submit.
Click on the follow URL: https://webapp.eecs.yorku.ca/submit
STEP 1 — If you don’t have an EECS account,
click here to use Passport York (everyone
has a passport York account).
If you do have an EECS account, enter here
and go to STEP 3.
STEP 1 — If you don’t have an EECS account,
click here to use Passport York (everyone
has a passport York account).
If you do have an EECS account, enter here
and go to STEP 3.
STEP 1 — If you don’t have an EECS account,
click here to use Passport York (everyone
has a passport York account).
If you do have an EECS account, enter here
and go to STEP 3.
STEP 2 – Enter your passport York
username/password.
Page 9/10
STEP 3 – Select the correct menu option
as follows. Term “F”, Course “1015”,
Assignment “Lab4”.
STEP 3 cont’ – Select your file. The location
in PyCharm may be complicated. I
recommend you save your PyCharm Python
file to your desktop and select from there.
Remember, name your file midterm.py.
STEP 3 cont’ – once you have entered
everything above, click “Submit Files”.
STEP 4 – Confirm that you have entered
everything in correctly. If you make a
mistake here and submit to the wrong
course, or wrong lab, we won’t be able to
tell and will mark your lab as not submitted.
Please double check before clicking OK.
midterm
midterm.py
Page 10/10
For more details on websubmit, see EECS department instructions:
https://wiki.eecs.yorku.ca/dept/tdb/services:submit:websubmit
STEP 5 – After you submit, your webpage
will refresh and show that you have
submitted the files and the time.
I recommend you logout.
You can resubmit the file if you make
changes. However, if the TA has already
graded your lab, they will not grade it again,
so I recommend you only upload once you
have it work.
midterm.py
midterm.py